View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4862-Insertion-11 (Length: 145)
Name: NF4862-Insertion-11
Description: NF4862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4862-Insertion-11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 8e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 8e-56
Query Start/End: Original strand, 8 - 144
Target Start/End: Complemental strand, 38087331 - 38087194
Alignment:
| Q |
8 |
gttagatttatcatatgtaagttagttgattagaaaa-cggttttaagtttctgttttgttagttacgctacggttaatagtgtgccagtcatatgttgg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
38087331 |
gttagatttatcatatgtaagttagttgattagaaaaacggttttaagtttccgttttgttagttatgctatagttaatagtgtgccagtcatatgttgg |
38087232 |
T |
 |
| Q |
107 |
actaacaattgcattatgtataaataatttgagatttt |
144 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38087231 |
actaacaattgcattatgtatgaataatttgagatttt |
38087194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University