View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4862-Insertion-16 (Length: 140)

Name: NF4862-Insertion-16
Description: NF4862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4862-Insertion-16
NF4862-Insertion-16
[»] chr1 (1 HSPs)
chr1 (7-140)||(2325460-2325593)


Alignment Details
Target: chr1 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 7 - 140
Target Start/End: Complemental strand, 2325593 - 2325460
Alignment:
7 ataaccatcatgaagaacaacaagggtacccttatcctattggtggtttatttgcaagcatgagtagtagtcaaatgggaccaggttttggtgctgctgc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2325593 ataaccatcatgaagaacaacaagggtacccttatcctattggtggtttatttgcaagcatgagtagtagtcaaatgggaccaggttttggtgctgctgc 2325494  T
107 tggtggaattccacaaccaaacccatcttcagat 140  Q
    ||||||||||||||||||||||||||||||||||    
2325493 tggtggaattccacaaccaaacccatcttcagat 2325460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University