View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4862_high_5 (Length: 262)

Name: NF4862_high_5
Description: NF4862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4862_high_5
NF4862_high_5
[»] chr2 (1 HSPs)
chr2 (15-240)||(36166583-36166808)


Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 240
Target Start/End: Complemental strand, 36166808 - 36166583
Alignment:
15 tcaaaggggtggaggaggaggcttgggaagagtttcaagtgattgggtagatgagttttgtgttgaaagaaaaattaaagagattcaaaggagtgattaa 114  Q
    ||||| ||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
36166808 tcaaaagggtggaggaggaggcttgggaagagtttcaagtgatcgggtggatgagttttgtgttgaaagaaaaattaaagagattcaaaggagtgattaa 36166709  T
115 agagtggaataaggtggaatatgggaagttggaggataggctagtgttgcttatggaggaaattgcaaagttgtgagaagggagggagggagtttaacgc 214  Q
    ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||    
36166708 agagtggaataaggtggaatatgagaagttggaggatatgctagtgttgcttatggaggaaattgcaaagttgtgagaggggagggagggattttaacgc 36166609  T
215 atgaggaggtggaggtgaggaaaatt 240  Q
    ||| ||||||||||||||||||||||    
36166608 atgcggaggtggaggtgaggaaaatt 36166583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University