View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4862_high_5 (Length: 262)
Name: NF4862_high_5
Description: NF4862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4862_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 240
Target Start/End: Complemental strand, 36166808 - 36166583
Alignment:
| Q |
15 |
tcaaaggggtggaggaggaggcttgggaagagtttcaagtgattgggtagatgagttttgtgttgaaagaaaaattaaagagattcaaaggagtgattaa |
114 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36166808 |
tcaaaagggtggaggaggaggcttgggaagagtttcaagtgatcgggtggatgagttttgtgttgaaagaaaaattaaagagattcaaaggagtgattaa |
36166709 |
T |
 |
| Q |
115 |
agagtggaataaggtggaatatgggaagttggaggataggctagtgttgcttatggaggaaattgcaaagttgtgagaagggagggagggagtttaacgc |
214 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
36166708 |
agagtggaataaggtggaatatgagaagttggaggatatgctagtgttgcttatggaggaaattgcaaagttgtgagaggggagggagggattttaacgc |
36166609 |
T |
 |
| Q |
215 |
atgaggaggtggaggtgaggaaaatt |
240 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
36166608 |
atgcggaggtggaggtgaggaaaatt |
36166583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University