View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4863_high_5 (Length: 528)
Name: NF4863_high_5
Description: NF4863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4863_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 359; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 18 - 376
Target Start/End: Original strand, 28182198 - 28182556
Alignment:
| Q |
18 |
cgacgcaccgatctgcgaccgcggccggtcattctccgcaaaggaaacaaccgttttgatccactggagaatacaacgacggagagacgatcggaggaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182198 |
cgacgcaccgatctgcgaccgcggccggtcattctccgcaaaggaaacaaccgttttgatccactggagaatacaacgacggagagacgatcggaggaat |
28182297 |
T |
|
| Q |
118 |
tgagcgcagagattacaacttgcattgaacgtttgagtttcaaaatatcttcaccggaaattgaacaacctatatccaccaccgtgacaagatccaccgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182298 |
tgagcgcagagattacaacttgcattgaacgtttgagtttcaaaatatcttcaccggaaattgaacaacctatatccaccaccgtgacaagatccaccgg |
28182397 |
T |
|
| Q |
218 |
cggccgatttaccaccgcattatacggctttgccttcacctttaacactgcaattaacgtctcgaagctcttgttagatgctactagagcagtttctggt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182398 |
cggccgatttaccaccgcattatacggctttgccttcacctttaacactgcaattaacgtctcgaagctcttgttagatgctactagagcagtttctggt |
28182497 |
T |
|
| Q |
318 |
agaaaaaacgcttcaaatgtttttgttgaagaaacatctaagccttgaaattcaacagg |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182498 |
agaaaaaacgcttcaaatgtttttgttgaagaaacatctaagccttgaaattcaacagg |
28182556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 428 - 525
Target Start/End: Original strand, 28182608 - 28182705
Alignment:
| Q |
428 |
gggtatggtgctgaagcgagaaacggaggcagaggacaggagtggctcgtcgtcgttgtagtttggaagcttcgacgacgtcgttgttttggcgttct |
525 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28182608 |
gggtatggtgctgaagcgagaaacggaggcagaggacaggagtggctcgtcgtcgttgtagtttggaagcttcgacaacgtcgttgttttggcgttct |
28182705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University