View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4864_low_2 (Length: 506)
Name: NF4864_low_2
Description: NF4864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4864_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 274
Target Start/End: Complemental strand, 41024412 - 41024157
Alignment:
| Q |
19 |
aaatttcctatagagagagacccaaaaacaacaaaaaagcgaaacaccgttgtatgaactgtcaaatgctggcgacccatttgtaacgcggtggctctgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41024412 |
aaatttcctatagagagagacccaaaaacaacaaaaaagcgaaacaccgttgtatgaactgtcaaatgctggcgacccatttgtaacgcggtggctctgc |
41024313 |
T |
|
| Q |
119 |
cacaaaccacctttcaaaaaatgggttccggtcagattagcggcggcgttggcggtggttctcatactaacaacggcggtggtagtaacagttgttgtga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41024312 |
cacaaaccacctttcaaaaaatgggttccggtcagattagcggcggcgttggcggtggttctcatactaacaacggcggtggtagtaacagttgttgtga |
41024213 |
T |
|
| Q |
219 |
tatgagtatgaagtgttggtgtaggtggagattagaaaatcaacactactataacc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41024212 |
tatgagtatgaagtgttggtgtaggtggagattagaaaatcaacactactataacc |
41024157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 362 - 489
Target Start/End: Complemental strand, 41024069 - 41023942
Alignment:
| Q |
362 |
ctccttctgttcatgaatctctttccccttttggttgtcatgatgacaatgagggttcttggtctattggaattttctatggtgattctcctttttctct |
461 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41024069 |
ctccttctgttcatgaatctctttccccttttggttgtcatgatgacaatgagggttcttggtctattggaattttctatggtgattctcctttttctct |
41023970 |
T |
|
| Q |
462 |
taaacccattgaatttgtaagtttctct |
489 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41023969 |
taaacccattgaatttgtaagtttctct |
41023942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University