View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4864_low_5 (Length: 321)
Name: NF4864_low_5
Description: NF4864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4864_low_5 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 130 - 321
Target Start/End: Complemental strand, 24511567 - 24511373
Alignment:
| Q |
130 |
tttcacaaagctagaaatgaatccccataacgactgcaaatgacaaccaagtcatggatgtgcatttcaattacgaaccaaattacaatccaaaa--ata |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
24511567 |
tttcacaaagctagaaatgaatccccataacgactgcaaatgacaaccaagtcatggatgtgcatttcaattacgaacaaaattacaatccaaaaatata |
24511468 |
T |
 |
| Q |
228 |
gtctcaactaacatgaaatttggaccagact-nnnnnnnncaaaattgtagtaacattagcagaaacatacggggcagaaaaagagaacaatggc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||| |||||||| |||| ||||||| |
|
|
| T |
24511467 |
gtctcaactaacatgaaatttggaccagactaaaaaaaaataaaattgtagtaacaccagcagacacatacggagcagaaaaggagagcaatggc |
24511373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 79
Target Start/End: Complemental strand, 24511685 - 24511616
Alignment:
| Q |
10 |
gcagaacctgtgcacaaaatgtacttttcctatcaaaacagaacaccaggaccacatgataataattgtc |
79 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24511685 |
gcagaaccattgcacaaaatgtacttttcctatcaaaacagaacacgaggaccacatgataataattgtc |
24511616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University