View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4864_low_5 (Length: 321)

Name: NF4864_low_5
Description: NF4864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4864_low_5
NF4864_low_5
[»] chr3 (2 HSPs)
chr3 (130-321)||(24511373-24511567)
chr3 (10-79)||(24511616-24511685)


Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 130 - 321
Target Start/End: Complemental strand, 24511567 - 24511373
Alignment:
130 tttcacaaagctagaaatgaatccccataacgactgcaaatgacaaccaagtcatggatgtgcatttcaattacgaaccaaattacaatccaaaa--ata 227  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||  |||    
24511567 tttcacaaagctagaaatgaatccccataacgactgcaaatgacaaccaagtcatggatgtgcatttcaattacgaacaaaattacaatccaaaaatata 24511468  T
228 gtctcaactaacatgaaatttggaccagact-nnnnnnnncaaaattgtagtaacattagcagaaacatacggggcagaaaaagagaacaatggc 321  Q
    |||||||||||||||||||||||||||||||          |||||||||||||||  |||||| |||||||| |||||||| |||| |||||||    
24511467 gtctcaactaacatgaaatttggaccagactaaaaaaaaataaaattgtagtaacaccagcagacacatacggagcagaaaaggagagcaatggc 24511373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 79
Target Start/End: Complemental strand, 24511685 - 24511616
Alignment:
10 gcagaacctgtgcacaaaatgtacttttcctatcaaaacagaacaccaggaccacatgataataattgtc 79  Q
    ||||||||  |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
24511685 gcagaaccattgcacaaaatgtacttttcctatcaaaacagaacacgaggaccacatgataataattgtc 24511616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University