View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4864_low_7 (Length: 217)
Name: NF4864_low_7
Description: NF4864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4864_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 106 - 199
Target Start/End: Complemental strand, 7936715 - 7936622
Alignment:
| Q |
106 |
aaggtgagacacaattggggtccatggctgagctggttgagttctacaattgtggtgcatgttgatcatgtaattgatcatgttttgctaatac |
199 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
7936715 |
aaggtgagacacagttggggtccatggctgagctggttgagttctacaattgtggtgcatgttgatcatgaatttgatcatgttttgctaatac |
7936622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 106 - 194
Target Start/End: Complemental strand, 7952649 - 7952561
Alignment:
| Q |
106 |
aaggtgagacacaattggggtccatggctgagctggttgagttctacaattgtggtgcatgttgatcatgtaattgatcatgttttgct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
7952649 |
aaggtgagacacaattggggtccatggctgagctggttgagttctacaattgtggtgcatgttgatcatgaatttgatcatgttttgct |
7952561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University