View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4864_low_7 (Length: 217)

Name: NF4864_low_7
Description: NF4864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4864_low_7
NF4864_low_7
[»] chr8 (2 HSPs)
chr8 (106-199)||(7936622-7936715)
chr8 (106-194)||(7952561-7952649)


Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 106 - 199
Target Start/End: Complemental strand, 7936715 - 7936622
Alignment:
106 aaggtgagacacaattggggtccatggctgagctggttgagttctacaattgtggtgcatgttgatcatgtaattgatcatgttttgctaatac 199  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||    
7936715 aaggtgagacacagttggggtccatggctgagctggttgagttctacaattgtggtgcatgttgatcatgaatttgatcatgttttgctaatac 7936622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 106 - 194
Target Start/End: Complemental strand, 7952649 - 7952561
Alignment:
106 aaggtgagacacaattggggtccatggctgagctggttgagttctacaattgtggtgcatgttgatcatgtaattgatcatgttttgct 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||    
7952649 aaggtgagacacaattggggtccatggctgagctggttgagttctacaattgtggtgcatgttgatcatgaatttgatcatgttttgct 7952561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University