View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4865-Insertion-12 (Length: 129)
Name: NF4865-Insertion-12
Description: NF4865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4865-Insertion-12 |
 | |
|
| [»] chr5 (4 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 4e-48; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 8 - 129
Target Start/End: Original strand, 3300082 - 3300211
Alignment:
| Q |
8 |
atgtgtgcttcccaaaccatgcatgtcattaattatattcggcatataaagtac--------atttcacctcacccttccatttactttcctgtcttcca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3300082 |
atgtgtgcttcccaaaccatgcatgtcattaattatattcggcatataaagtacctttcaccatttcacctcaccctttcatttactttcctgtcttcca |
3300181 |
T |
|
| Q |
100 |
tgtgttgcactcaaacatggctagttttac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3300182 |
tgtgttgcactcaaacatggctagttttac |
3300211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 8 - 129
Target Start/End: Original strand, 3392975 - 3393104
Alignment:
| Q |
8 |
atgtgtgcttcccaaaccatgcatgtcattaattatattcggcatataaagtac--------atttcacctcacccttccatttactttcctgtcttcca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3392975 |
atgtgtgcttcccaaaccatgcatgtcattaattatattcggcatataaagtacctttcaccatttcacctcaccctttcatttactttcctgtcttcca |
3393074 |
T |
|
| Q |
100 |
tgtgttgcactcaaacatggctagttttac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3393075 |
tgtgttgcactcaaacatggctagttttac |
3393104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 61 - 110
Target Start/End: Original strand, 39880491 - 39880540
Alignment:
| Q |
61 |
catttcacctcacccttccatttactttcctgtcttccatgtgttgcact |
110 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
39880491 |
catttcacctcaccctaccatttactttcctgtcttccatatgttgcact |
39880540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 1163217 - 1163164
Alignment:
| Q |
12 |
gtgcttcccaaaccatgcatgtcattaattatattcggcatataaagtacatttcacc |
69 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||| | ||||||| |
|
|
| T |
1163217 |
gtgcttcccaaaccatgcctgtcatta----tattcggcatataaagttcctttcacc |
1163164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.0000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 62 - 103
Target Start/End: Complemental strand, 25911698 - 25911657
Alignment:
| Q |
62 |
atttcacctcacccttccatttactttcctgtcttccatgtg |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25911698 |
atttcacctcaccctaccatttactttcctgtcttccatgtg |
25911657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University