View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4865-Insertion-5 (Length: 217)
Name: NF4865-Insertion-5
Description: NF4865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4865-Insertion-5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 8 - 174
Target Start/End: Complemental strand, 2914492 - 2914322
Alignment:
| Q |
8 |
agatgaagttgtttagttgagcgttatttgggattgagat-ttttggaagaaaat--tataacttgtaaatttaccaagtgtgattggacggtttgattt |
104 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2914492 |
agatgaagttgtttaggtgagtgttatttgggattgagatcttttggaagaaaatattataacttgtaaatttaccaagtgtgattggacggtttgattt |
2914393 |
T |
|
| Q |
105 |
catcttaattttgttgttttnnnnnnntcgcgcttgattgtttctaaattctaatatt-cggattttatat |
174 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2914392 |
catcttaattttgttgttttaaaaaaatcgcgcttgattgtttctaaattctaatattggggattttatat |
2914322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 2914137 - 2914087
Alignment:
| Q |
166 |
attttatatttatgcgacaattttgggattaagtttgctgaattttcggta |
216 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2914137 |
attttatatttatgcgacaattttaggattaagtttgctgaattttcggta |
2914087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University