View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4865_high_13 (Length: 203)

Name: NF4865_high_13
Description: NF4865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4865_high_13
NF4865_high_13
[»] chr3 (1 HSPs)
chr3 (7-51)||(3158547-3158591)
[»] chr8 (1 HSPs)
chr8 (1-33)||(23850778-23850810)


Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 51
Target Start/End: Original strand, 3158547 - 3158591
Alignment:
7 agaataatttttaaaataaccaattcagtcaattctaaatttttc 51  Q
    ||||||||||| |||||||||||||||||||||||||||||||||    
3158547 agaataattttaaaaataaccaattcagtcaattctaaatttttc 3158591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 23850810 - 23850778
Alignment:
1 aattttagaataatttttaaaataaccaattca 33  Q
    ||||||||||||||||| |||||||||||||||    
23850810 aattttagaataattttaaaaataaccaattca 23850778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University