View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4865_high_14 (Length: 201)
Name: NF4865_high_14
Description: NF4865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4865_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 178
Target Start/End: Original strand, 34327642 - 34327803
Alignment:
| Q |
17 |
cacagatagttggttggatgagacaattggtttgaaggaatgtagagtgaagtgtttggataattgttcttgtatggcatatgaaaatttagatgtaaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34327642 |
cacagatagttggttggatgagacaattggtttgaaggaatgtagagtgaagtgtttggataattgttcttgtatggcatatgcaaatttagatgtaaga |
34327741 |
T |
 |
| Q |
117 |
gaagggagtggatgtgccttgtggtttggtgatttaattgatattagacggtttgagcttag |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34327742 |
gaagggagtggatgtgccttgtggtttggtgatttaattgatattagacagtttgagcttag |
34327803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 115 - 163
Target Start/End: Complemental strand, 23562052 - 23562004
Alignment:
| Q |
115 |
gagaagggagtggatgtgccttgtggtttggtgatttaattgatattag |
163 |
Q |
| |
|
||||||| ||||| |||| | |||||||||||||||||||||||||||| |
|
|
| T |
23562052 |
gagaaggcagtggctgtgtcatgtggtttggtgatttaattgatattag |
23562004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University