View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4865_low_11 (Length: 234)
Name: NF4865_low_11
Description: NF4865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4865_low_11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 234
Target Start/End: Original strand, 42895649 - 42895866
Alignment:
| Q |
14 |
caaccatcattgttactattatatatttgcatgctctgttttgtgatgctagtttagacttcaacgtaaaagttactatttttgtatagggtttttgcca |
113 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42895649 |
caaccatcactgttactattatatatttgcatgctctgttttgtgatgctagtttagacttcaacgtaaaagttactatttttgtataggggttttgcca |
42895748 |
T |
|
| Q |
114 |
aatattaggnnnnnnnnnngccgtggttttgttaattatctgatttatttgtttctttactagcttatgtgagaatttgtggattgagctggaattttta |
213 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42895749 |
aatattagg-tttttttttgccgtggttttgttaattatctgatttatttgtttctttactagcttatgtgagaatttgtggattgagctggaa--ttta |
42895845 |
T |
|
| Q |
214 |
gttttcggggatttttctggt |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42895846 |
gttttcggggatttttctggt |
42895866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University