View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4865_low_12 (Length: 209)
Name: NF4865_low_12
Description: NF4865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4865_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 51823857 - 51823679
Alignment:
| Q |
16 |
cataagtttcattcaagtcataactttaatctttacatgatcttaatcagttgagtggtcttcaacaactagtgcttcataatcagcatttgctcttagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51823857 |
cataagtttcattcaagtcataactttaatctttacatgatcttaatcagttgagtggtcttcaacaactagtgcttcataatcagcatttgctcttagt |
51823758 |
T |
 |
| Q |
116 |
gatttgctgcttcttcactcatatgcaaaatgaccaaaactttgacaactatagcacctgactttcttccagtataattta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
51823757 |
gatttgctgcttcttcactcatatgcaaaatgaccaaaactttgacaa--ttagcacctgactttcttccagtaaaattta |
51823679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 126 - 158
Target Start/End: Complemental strand, 51834466 - 51834434
Alignment:
| Q |
126 |
ttcttcactcatatgcaaaatgaccaaaacttt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51834466 |
ttcttcactcatatgcaaaatgaccaaaacttt |
51834434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University