View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4865_low_13 (Length: 204)
Name: NF4865_low_13
Description: NF4865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4865_low_13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 17109998 - 17110195
Alignment:
| Q |
18 |
ctacctagatccatatcaactttacagattttggggaactgtccattccttttagaaagatgcaagaaaccttatggaaagga-----------ttgcgc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17109998 |
ctacctagatccatatcaactttacagatttcggggaactgtccattccttttagaaagatgcaagaaaccttatggaaaggattgcgagaggattgcgc |
17110097 |
T |
 |
| Q |
107 |
atattcaatgtataatgattgacgatcctgagagggaccaacagtcatagtgcccaacaattactcaggtacctactatttacatgttttcttttggt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17110098 |
atattcaatgtataatgattgacgatcctgagagggaccaacagtcatagtgcccaacaattactcaggtacctactatttacatgttttcttttggt |
17110195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University