View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4865_low_6 (Length: 272)
Name: NF4865_low_6
Description: NF4865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4865_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 25 - 254
Target Start/End: Original strand, 3158292 - 3158527
Alignment:
| Q |
25 |
catgcgttgaaacattttaatcaattaaggctttataaattgcacattgtatatctgatgtttagtctccacgactctgtgattttaaattagtttgtgg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| | |
|
|
| T |
3158292 |
catgcgttgaaacattttaatcaattaaggctttataaattgcacattgtatatctgatgtttagtctccacgaccctgtgattttaaattagtatgtcg |
3158391 |
T |
|
| Q |
125 |
agacattgtataatatatacaatagtctaattcaaact-----tttc-ccttactttcaaatattacgttaaatgaaggtctaaacaaaggccgcacatt |
218 |
Q |
| |
|
|||||| |||||||||| ||||||||||| ||||||| |||| | |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3158392 |
ggacattatataatatatgcaatagtctaaatcaaactttcactttcacgttactttcaaatattacgataaatgaaggtctaaacaaaggccgcacatt |
3158491 |
T |
|
| Q |
219 |
gatcctcggtataatattacattcaatttcgataat |
254 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3158492 |
gatcctcggcataatattacattcaatttcgataat |
3158527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 71
Target Start/End: Complemental strand, 23853165 - 23853114
Alignment:
| Q |
20 |
ggcttcatgcgttgaaacattttaatcaattaaggctttataaattgcacat |
71 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
23853165 |
ggcttcataccttgaaacattttaatcaattaaggctttaaaagttgcacat |
23853114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 23851033 - 23850996
Alignment:
| Q |
20 |
ggcttcatgcgttgaaacattttaatcaattaaggctt |
57 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23851033 |
ggcttcatgcgttgaaacatgttaatcaattaaggctt |
23850996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University