View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4867-Insertion-12 (Length: 345)
Name: NF4867-Insertion-12
Description: NF4867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4867-Insertion-12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 8 - 265
Target Start/End: Complemental strand, 28805528 - 28805263
Alignment:
| Q |
8 |
ctattttccctgcaacatgaat---cattcttaattagtactaaaacacaataatcaaa------atcaaaactttgtttgctaaatttcaaaccttgtg |
98 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
28805528 |
ctatttgccctgcaacattaataaacattcttaattagtactaaaacacaataatcaaattcaaaatcaaaactttagttgctaaatttcaaaccttgtg |
28805429 |
T |
|
| Q |
99 |
gagtttgattctctcttcgctccgttacaaaaaattcccatgttcaattttcaattctaatttctctcccactcttgataaactaagaaaccccctcttc |
198 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||| |
|
|
| T |
28805428 |
gagtttgattctctcttcgctccattacaaaaaattcccatgttcaattttcaattctaatttctctcccactcttgataaactaa-aaaaccccttttc |
28805330 |
T |
|
| Q |
199 |
taaaaaggacataaagttcgataaaaataacaactttaccacaatttcgacccgttttcaattcggg |
265 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28805329 |
taaaaaggtcataaagttcgataaaaataacaactttaccacaatttcgacccgttttcaaatcggg |
28805263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University