View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4867-Insertion-7 (Length: 581)
Name: NF4867-Insertion-7
Description: NF4867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4867-Insertion-7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 312; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 312; E-Value: 1e-175
Query Start/End: Original strand, 173 - 504
Target Start/End: Complemental strand, 21269079 - 21268748
Alignment:
| Q |
173 |
ttatccttcttgggaagtggtgacatgagttcaactttcttcttaatcttctcagcaagattgtctctcagttttgtggggtccacatttccggtgacgg |
272 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269079 |
ttatccttcttgggaattggtgaaatgagttcaactttcttcttaatcttctcagcaagattgtctctcagttttgtggggtccacatttccggtgacgg |
21268980 |
T |
|
| Q |
273 |
ttacttttccggtttcactctctgctttcaccgtatcaacaccttaaaaacagaaacatggttgttcaattttaacgattgaaaaatgaattgaagaaca |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268979 |
ttacttttccggtttcactctctgctttcaccgtatcaacaccttaaaaacagaaacatggttgttcaattttaacgattgaaaaatgaattgaagaaca |
21268880 |
T |
|
| Q |
373 |
atgatgaaaacccagatcggaaaaaatgtgtagaaacagaggagtgtgagaaaaatgatacctttgatactgttaaggtgtttggttactttgttagcgc |
472 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||| |
|
|
| T |
21268879 |
atgatgaaaacccagatcggaaaaaatgtgtagaaacagaggagtgtgagaaaaatgatacctttgatgccgttaaggtgtttggtgactttgttagcgc |
21268780 |
T |
|
| Q |
473 |
aaccttcgcaatgcatatagactttcaaaacc |
504 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21268779 |
aaccttcgcaatgcatatagactttcaaaacc |
21268748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University