View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4867-Insertion-9 (Length: 376)
Name: NF4867-Insertion-9
Description: NF4867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4867-Insertion-9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 8 - 375
Target Start/End: Complemental strand, 27309517 - 27309150
Alignment:
| Q |
8 |
caaaattcatcctctgccatgccactgcctttgtcaatgaaaaccttctatccacacatcaaatttcattcaccccacctaatgtgatgttctaatcttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27309517 |
caaaattcatcctctgccatgccactgcctttgtcaatgaaaaccttctatccatacatcaaatttcattcaccccacctcatgtgatgttctaatcttc |
27309418 |
T |
 |
| Q |
108 |
cctaccagattgcctttcaacaatctgatgatcatttcaggatctgcctccacttaattaatcaaatcttctgtctcatcttgagcagtttgtcttggtc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27309417 |
cctaccagattgcctttcaacaatctgatgatcatttcaggatctgcctccacttaattaatcgaatcttctgtctcatcttgagcaatttgtcttggtc |
27309318 |
T |
 |
| Q |
208 |
taaaactgaaacttttgcactgcctctttctccagtaggtttatcattttgaaaaatctctttgtaagatacccctttatcacatgattagtattgttct |
307 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27309317 |
taaaactgaaacttttgcactacctctttctccaataggtttatcattttgcaaaatctctttgtaagatacccctttatcacatgattagtattgttct |
27309218 |
T |
 |
| Q |
308 |
ccttggcaatctatttatcccatgttcttcgtttatcttttactaccccaccctgaatattgtaatgt |
375 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27309217 |
cctcgacaatctatttatcccatgttcttcgtttatcttttactaccccaccctgaatattgtaatgt |
27309150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University