View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4867_high_8 (Length: 248)
Name: NF4867_high_8
Description: NF4867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4867_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 14 - 236
Target Start/End: Original strand, 31688862 - 31689084
Alignment:
| Q |
14 |
atcaatacatttgtggttcatattgttcaatctaaactgttcgattttgatcaaatggtcacaagtgtgcttaccatatcattcgatttnnnnnnnncta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||| ||| |
|
|
| T |
31688862 |
atcaatacatttgtggttcatattgttcaatctaaactgttcgattttgatcaaatagtcacaagtgtgcttaccgtgtcattcgatttaaaaaaaacta |
31688961 |
T |
 |
| Q |
114 |
ggttcactaatgtggcacctaaaaatcaaacaaggtctctaatgggaacccaaacacactagtgattgtaatttgtaaaagtcccccttcaaaagcatat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31688962 |
ggttcactaatgtggcacctaaaaatcaaacaaggtctctaatgggaacccaaacacactagtgattgtaatttgtaaaaatcccccttcaaaagcatat |
31689061 |
T |
 |
| Q |
214 |
atttggccacactggttgtttgt |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31689062 |
atttggccacactggttgtttgt |
31689084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University