View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4867_low_12 (Length: 240)
Name: NF4867_low_12
Description: NF4867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4867_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 40658431 - 40658210
Alignment:
| Q |
1 |
ctggaccttctcaattacaacgttgccatcactatgattggattgggatggagaaaaggactagctgcaatggtacattacccagccattatttcttatc |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40658431 |
ctggaccttctcaataacaacgttgccatcactatgattggattgggatggagaaaaggactagctgcaatggtacattactcagccattatttcttatc |
40658332 |
T |
 |
| Q |
101 |
ttggtacgtcgcgacagcaaggacgtggagctgtgtcgtgagtttatagaaaaccttttatagatctgtcattatcttctcataacctcatgggacattg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| || | |
|
|
| T |
40658331 |
ttggtacgtcgcgacagcaaggacgtggagctgtgtcgtgagtttatagaaaaccttttatagatctgttattatcttctcataatctcatgggatatgg |
40658232 |
T |
 |
| Q |
201 |
gaccacgtcagacccatgtatt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40658231 |
gaccacgtcagacccatgtatt |
40658210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University