View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4867_low_16 (Length: 216)

Name: NF4867_low_16
Description: NF4867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4867_low_16
NF4867_low_16
[»] chr5 (1 HSPs)
chr5 (18-201)||(40042792-40042975)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 40042792 - 40042975
Alignment:
18 aaaactagtgccgataacgcctcgtaggaagcggtgtctttcgccgtctttctccatgatagagtcctttcccatgagatgaactgaggaagaaggccaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40042792 aaaactagtgccgataacgcctcgtaggaagcggtgtctttcgccgtctttctccatgatagagtcctttcccatgagatgaactgaggaagaaggccaa 40042891  T
118 gagctttttaccagcttgaactcattggacaaaataaacttatttgcctcagctccatttactatcacagttggtgaccctatg 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40042892 gagctttttaccagcttgaactcattggacaaaataaacttatttgcctcagctccatttactatcacagttggtgaccctatg 40042975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University