View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4867_low_4 (Length: 271)
Name: NF4867_low_4
Description: NF4867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4867_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 6 - 253
Target Start/End: Complemental strand, 2603066 - 2602824
Alignment:
| Q |
6 |
tgtgtggttttgggacggatgaggtaaatgtctgtttaaacatgagggaataataatatccaaaatgtttttgcttctttctcttgataaaataaatgct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2603066 |
tgtgtggttttgggacggatgaggtaaatgtctgtttaaacatgagggaataataatatccaaaatgtttttgcttctttttcttgataaaataaatgct |
2602967 |
T |
 |
| Q |
106 |
cttacttagcttgtgcaaggaaacgaaatacattcaatgtaaattattactactaggttagaatagaaggaaaccaagtatannnnnnngtttgtgtatg |
205 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
2602966 |
ctta-----cttgtgcaaggaaacgaaatacattcaatgtaaattattactaataggttggaatagaaggaaaccaagtatatttttttgtttgtgtatg |
2602872 |
T |
 |
| Q |
206 |
gatacaaatattaatacattaatttggcgagttatgttaagtcaataa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2602871 |
gatacaaatattaatacattaatttggcgagttatgttaagtcaataa |
2602824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University