View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4867_low_9 (Length: 247)
Name: NF4867_low_9
Description: NF4867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4867_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 15468761 - 15468982
Alignment:
| Q |
1 |
tatcaatcacaaagtaagtgtttgactctagagacgtggagcttaatttcaaccattaccaaattttggatcaaattaatcccactccaactttacaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15468761 |
tatcaatcacaaagtaagtgtttgactctagagacgtggggcttaacttcaaccattaccaaattttggatcaaattaatccctctccaactttacaaac |
15468860 |
T |
 |
| Q |
101 |
aatatgtttggtggtttagctaataaaaagagaatcatcaatcaaattaattataaaattagaaatgaaattaatctctacttttcttggtaaatgaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15468861 |
aatatgtttggtggtttagctaataaaaagagaatcatcaatcaaattaattataaaattagaaatgaatttaatctctacttttcttggtaaatgaatt |
15468960 |
T |
 |
| Q |
201 |
caatactagtttttatctctat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
15468961 |
caatactagtttttatctctat |
15468982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University