View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4868-Insertion-19 (Length: 130)
Name: NF4868-Insertion-19
Description: NF4868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4868-Insertion-19 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 8e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 8e-59
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 33278109 - 33277987
Alignment:
| Q |
8 |
cctacactgctgctggagaacccattcccactaacaagagacacgccgctgccaagattttcagccatcctgatgttgttgctgaagaaccatggtgact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33278109 |
cctacactgctgctggagaacccattcccactaacaagagacacgctgctgctaagattttcagccatcctgatgttgttgctgaagaaccatggtgact |
33278010 |
T |
|
| Q |
108 |
actctcatttccatttttagaga |
130 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33278009 |
actctcatttccatttttagaga |
33277987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 70; Significance: 6e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 6e-32
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 29442755 - 29442662
Alignment:
| Q |
10 |
tacactgctgctggagaacccattcccactaacaagagacacgccgctgccaagattttcagccatcctgatgttgttgctgaagaaccatggt |
103 |
Q |
| |
|
|||||| | |||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29442755 |
tacactccagctggagaacccattcccaccaacaagagacacgcagctgccaaggttttcagccatcctgatgttgttgctgaagtaccatggt |
29442662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 55 - 103
Target Start/End: Complemental strand, 26250037 - 26249989
Alignment:
| Q |
55 |
gctgccaagattttcagccatcctgatgttgttgctgaagaaccatggt |
103 |
Q |
| |
|
|||||||| ||||||||||| |||||||||| |||||| | |||||||| |
|
|
| T |
26250037 |
gctgccaaaattttcagccaccctgatgttgctgctgaggtaccatggt |
26249989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University