View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4868_high_13 (Length: 258)

Name: NF4868_high_13
Description: NF4868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4868_high_13
NF4868_high_13
[»] chr7 (2 HSPs)
chr7 (114-254)||(23862543-23862683)
chr7 (16-67)||(23862447-23862498)


Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 114 - 254
Target Start/End: Original strand, 23862543 - 23862683
Alignment:
114 ggcccccaacaaagaataaattagaaatgattgtaaacagatataannnnnnnnatttgcataaattaagcacatattaaaaacctacaccaagacataa 213  Q
    |||||||||||||||||||||||||||||||| |||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||    
23862543 ggcccccaacaaagaataaattagaaatgattataaacagatatccttttttttatttgcataaattaagcacatattaaaaacctacaccaagacataa 23862642  T
214 tagtctttaacttttattatgaaagaacaaataaatgaatc 254  Q
    |||||||| ||||||||||||||||||||||||||||||||    
23862643 tagtctttcacttttattatgaaagaacaaataaatgaatc 23862683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 16 - 67
Target Start/End: Original strand, 23862447 - 23862498
Alignment:
16 gagatgaacatactcgtttgaaggaatatatgaacatacttaatactactag 67  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||    
23862447 gagatgaacatactcttttgaaggaatatatgaacatacttaatactactag 23862498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University