View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4868_high_19 (Length: 246)
Name: NF4868_high_19
Description: NF4868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4868_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 13069650 - 13069422
Alignment:
| Q |
1 |
ttcagaatcggttttgatttcatatttctttgggagatcggagttaatgaactcacccagaggcgtgagagctgcatgatgaacatcaaattcaaatcca |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13069650 |
ttcaggatcggttttgatttcatatttctttgggagatcggagttaatgaactcacccagaggcgtgagagctgcatgatgaacatcaaattcaaatcca |
13069551 |
T |
|
| Q |
101 |
aataaatagaattgtagnnnnnnnnnnnnnnnnnnaaaaaggtaatctagtccgcttaaattggtattggggagaattgaatacgaaagttggaggagga |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
13069550 |
aataaatagaattgtagttttttattttattttttaaaaaggtaatctagtccgcttaaattggtattggggagaatcgaatacgaaagctggaggagga |
13069451 |
T |
|
| Q |
201 |
gcacatttcatggtcagaagctgcgaatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13069450 |
gcacatttcatggtcagaagctgcgaatg |
13069422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University