View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4868_high_24 (Length: 207)
Name: NF4868_high_24
Description: NF4868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4868_high_24 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 102 - 207
Target Start/End: Original strand, 30216745 - 30216850
Alignment:
| Q |
102 |
cagctcattgatttgattttgagtcgcattttgcattgcattggggtttgtgattcatgtgtttttaattaaagtagataaagtgagaatcagaggaatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30216745 |
cagctcattgatttgattttgagtcgcattttgcattgcattggggtttgtgattcatgtgtttttaattaaagtagataaagtgagaatcagaggaatt |
30216844 |
T |
 |
| Q |
202 |
agatta |
207 |
Q |
| |
|
|||||| |
|
|
| T |
30216845 |
agatta |
30216850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 30216634 - 30216717
Alignment:
| Q |
1 |
tctctctttctttcattcttcttcaccctccgacaaacactgattcaaaaccagtattgttgtttttctcaaatcccaaaaata |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30216634 |
tctctctttctttcattcttcttcaccctccgacaaacactgattcaaaaccagtattgttgtttttctcaaatcccaaaaata |
30216717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University