View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4868_low_15 (Length: 258)
Name: NF4868_low_15
Description: NF4868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4868_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 114 - 254
Target Start/End: Original strand, 23862543 - 23862683
Alignment:
| Q |
114 |
ggcccccaacaaagaataaattagaaatgattgtaaacagatataannnnnnnnatttgcataaattaagcacatattaaaaacctacaccaagacataa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23862543 |
ggcccccaacaaagaataaattagaaatgattataaacagatatccttttttttatttgcataaattaagcacatattaaaaacctacaccaagacataa |
23862642 |
T |
|
| Q |
214 |
tagtctttaacttttattatgaaagaacaaataaatgaatc |
254 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23862643 |
tagtctttcacttttattatgaaagaacaaataaatgaatc |
23862683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 16 - 67
Target Start/End: Original strand, 23862447 - 23862498
Alignment:
| Q |
16 |
gagatgaacatactcgtttgaaggaatatatgaacatacttaatactactag |
67 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23862447 |
gagatgaacatactcttttgaaggaatatatgaacatacttaatactactag |
23862498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University