View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4868_low_16 (Length: 252)
Name: NF4868_low_16
Description: NF4868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4868_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 31956182 - 31955941
Alignment:
| Q |
1 |
aaagcaacatgtggtctctagaagtaagacaaa-gctgaataataaaaacaaggctttggtcacttgtggcttctgagttgcttaaagctccatttctaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31956182 |
aaagcaacatgtggtctctagaagtaagacaaaagctgaataataaaaacaaggctttggtcacttgtggcttcttagttgcttaaagctccatttctaa |
31956083 |
T |
|
| Q |
100 |
ctccaacagnnnnnnngttacaacatgagtgcatttgctttgactcacaatcttatcgttttgcatgtcaggaccaagcatattgagctggacctgtttt |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31956082 |
ctccaacagtttttttgttacaacatgagtgcatttgctttgactcacaatcttatcgttttgcatgtcaggaccaagcatattgagctggacctgtttt |
31955983 |
T |
|
| Q |
200 |
tgttagagaaacggttcttagaaacaactaaatggggttcat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31955982 |
tgttagagaaacggttcttagaaacaactaaatggtgttcat |
31955941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University