View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4868_low_20 (Length: 247)
Name: NF4868_low_20
Description: NF4868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4868_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 48767359 - 48767601
Alignment:
| Q |
1 |
gtatattcttgtatgatgcacaactacaagatggtctttatatataaactgannnnnnn-ccacttttgagatgtttggatatccacctcttcaccaatg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48767359 |
gtatattcttgtatgatgcacaactacaagatggtctttatatataaactgattttttttccacttttgagatgtttggatatccacctcttcaccaatg |
48767458 |
T |
|
| Q |
100 |
cacaaaccctctaactgtggccggcaaattggttggagctactatgagaagaagtgccatggttcatcaagaaacgaacaacgacacaagtgatattgtc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48767459 |
cacaaaccctctaactgtggccggcaaattggttggagctactatgagaagaagtgccttggttcatcaagaaacgaacaacgacacaagtgatattgtc |
48767558 |
T |
|
| Q |
200 |
agcactacctctctgatatgcttcttgcatcagtctctctgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48767559 |
agcactacctctctgatatgcttcttgcatcagtctctttgct |
48767601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 161 - 242
Target Start/End: Complemental strand, 3412411 - 3412330
Alignment:
| Q |
161 |
gttcatcaagaaacgaacaacgacacaagtgatattgtcagcactacctctctgatatgcttcttgcatcagtctctctgct |
242 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| || ||||||| ||||||||||||||| ||||||| |||||| |||| |||| |
|
|
| T |
3412411 |
gttcatcaggaaacgaacgacgacacaagtaatgttgtcagaactacctctctgatacgcttctttcatcagcctctttgct |
3412330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 161 - 242
Target Start/End: Original strand, 3434414 - 3434495
Alignment:
| Q |
161 |
gttcatcaagaaacgaacaacgacacaagtgatattgtcagcactacctctctgatatgcttcttgcatcagtctctctgct |
242 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| || ||||||| ||||||||||||||| ||||||| |||||| |||| |||| |
|
|
| T |
3434414 |
gttcatcaggaaacgaacgacgacacaagtaatgttgtcagaactacctctctgatacgcttctttcatcagcctctttgct |
3434495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University