View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4868_low_26 (Length: 219)
Name: NF4868_low_26
Description: NF4868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4868_low_26 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 18198776 - 18198575
Alignment:
| Q |
18 |
catgtgtcaattgtcaaacacggaacacgccttcaaaccaaggtgtcaatgtgacctattccaaatcaaatcatctcatggaacaaaagtgacctggata |
117 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18198776 |
catgtgtcaattgtcaaacaccgagcacgccttcaaaccaaggtgtcaatgtgacctattccaaatcaaatcatctcatggaacaaaagtgaccttgata |
18198677 |
T |
 |
| Q |
118 |
aagctgcagggttagaagcaaaacccttggaaagtcgtccatctctcgcatgtttccctaaagtttgtttatttggttcatcaaactgtgttgagataga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18198676 |
aagctgcagggttagaagcaaaacccttggaaagtcgtccatctctcgaatgtttccctaaagttagtttatttggttcatcaaactgtgttgagataga |
18198577 |
T |
 |
| Q |
218 |
tt |
219 |
Q |
| |
|
|| |
|
|
| T |
18198576 |
tt |
18198575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 74 - 127
Target Start/End: Complemental strand, 18194121 - 18194068
Alignment:
| Q |
74 |
tattccaaatcaaatcatctcatggaacaaaagtgacctggataaagctgcagg |
127 |
Q |
| |
|
|||||| ||||||||| ||||||| |||| ||| ||||| |||||||||||||| |
|
|
| T |
18194121 |
tattcccaatcaaatcctctcatgaaacacaagagaccttgataaagctgcagg |
18194068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 75 - 132
Target Start/End: Complemental strand, 18231516 - 18231459
Alignment:
| Q |
75 |
attccaaatcaaatcatctcatggaacaaaagtgacctggataaagctgcagggttag |
132 |
Q |
| |
|
||||| ||||||||| |||||||||||| ||| ||||| ||||||||| |||| |||| |
|
|
| T |
18231516 |
attcccaatcaaatcctctcatggaacacaagagaccttgataaagctacaggattag |
18231459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University