View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4869-Insertion-4 (Length: 600)

Name: NF4869-Insertion-4
Description: NF4869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4869-Insertion-4
NF4869-Insertion-4
[»] chr2 (23 HSPs)
chr2 (8-599)||(11424763-11425357)
chr2 (471-597)||(9318767-9318892)
chr2 (467-597)||(9326631-9326758)
chr2 (522-599)||(9285084-9285161)
chr2 (518-599)||(10346911-10346992)
chr2 (523-598)||(9273269-9273344)
chr2 (521-599)||(9271924-9272002)
chr2 (521-599)||(9291175-9291253)
chr2 (518-599)||(9287806-9287887)
chr2 (518-599)||(10371038-10371119)
chr2 (521-599)||(10334936-10335014)
chr2 (522-599)||(9062079-9062160)
chr2 (518-574)||(9315308-9315364)
chr2 (532-589)||(10340673-10340730)
chr2 (521-578)||(10351395-10351452)
chr2 (523-583)||(7116943-7117003)
chr2 (523-599)||(12007142-12007218)
chr2 (521-578)||(9076551-9076608)
chr2 (516-578)||(9068944-9069006)
chr2 (522-570)||(9363719-9363767)
chr2 (523-570)||(12019789-12019836)
chr2 (467-505)||(8574309-8574347)
chr2 (523-599)||(11988322-11988398)
[»] chr8 (1 HSPs)
chr8 (523-599)||(41968296-41968372)
[»] scaffold0667 (1 HSPs)
scaffold0667 (523-597)||(1771-1845)
[»] chr3 (1 HSPs)
chr3 (522-599)||(37461610-37461687)
[»] chr4 (1 HSPs)
chr4 (467-599)||(26574171-26574297)
[»] chr1 (2 HSPs)
chr1 (523-599)||(29454250-29454326)
chr1 (523-566)||(29422436-29422479)


Alignment Details
Target: chr2 (Bit Score: 498; Significance: 0; HSPs: 23)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 498; E-Value: 0
Query Start/End: Original strand, 8 - 599
Target Start/End: Original strand, 11424763 - 11425357
Alignment:
Q  8 ggttctgccatgtttttgtcaaattcgtctttatttctgagcaaactagtggttttatgaagttgagtgctaccaatgagtacaactaaaatgatactat 107  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11424763 ggttctgccgtgtttttgtcaaattcgtctttatttctgagcaaactagtggttttatgaagttgagtgctaccaatgagtacaactaaaatgatactat 11424862  T
Q  108 gaaagctatggtttactgcagtgttacattagtcatgtaatcattgtggtttgttaaattcagattttgtttgtgttgattgattaactattgtgtagtg 207  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11424863 gaaagctatggttcactgcagtgttacattagtcatgtaatcattgtggtttgttaaattcagattttgtttgtgttgattgattaactattgtgtagtg 11424962  T
Q  208 gaatctaaatccgttgttcaattacaaagtgttttcaaagatcaaaataattggtttt-aatagtatttcatgaactttttactcatttacaaaattatt 306  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  11424963 gaatctaaattggttgttcaattacaaagtgttttcaaagatcaaaataattggttttaaatagtatttcatgaactttttactcatttacaaaattatt 11425062  T
Q  307 --tatttcaaatgagttgtaagtccatccagtagtaaacaagcatatgaaagcttaccaatcaatcaaaatgaaaattcaactcatgttccaagtnnnnn 404  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||         
T  11425063 tatatttcaaatgagttgtaagtccatccagtagtaaacaagcatatgaaagcttaccaatcaatcaaaatgaaaattcaactcatgttctaagt-cccc 11425161  T
Q  405 nntactaatgcactttttctccccaagtctgtctacaaaaacaatgtagatttcattgactgattcttttgtgattttgttgaacttacttggatgagat 504  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11425162 cctactaatgcactttttctccccaagtctgtctacaaaaacaatgtagatttcattgactgattcttttgtgattttgttgaacttacttggatgagat 11425261  T
Q  505 tta-nnnnnnngtcttcccacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    |||        |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  11425262 ttattttttttgtcttcccacagggacgacttcttgtcccgaggatttaaattgacattgtaagggatggaaggatggacctgtgatgtgcagctg 11425357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 471 - 597
Target Start/End: Complemental strand, 9318892 - 9318767
Alignment:
Q  471 ttttgtgattttgttgaacttacttggatgagatttannnnnnngtcttcccacagggacgacttcttgtcccgaggatttaaattgatattgtaaggga 570  Q
    ||||||||| ||||||||||| ||| ||||||||| |        |||||| |||||||||||||||||||||||||||||||||||| |||||||||||    
T  9318892 ttttgtgatattgttgaacttgctttgatgagattcatttttttttcttcc-acagggacgacttcttgtcccgaggatttaaattgagattgtaaggga 9318794  T
Q  571 tggaaggatggacctgtgatgtgcagc 597  Q
    |||||||| ||||||||||||||||||    
T  9318793 tggaaggaaggacctgtgatgtgcagc 9318767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 467 - 597
Target Start/End: Complemental strand, 9326758 - 9326631
Alignment:
Q  467 attcttttgtgattttgttgaacttacttggatgagatttannnnnnngtcttcccacagggacgacttcttgtcccgaggatttaaattgatattgtaa 566  Q
    ||||||||||||| ||||||||||||||| ||||||||| |        |||| ||||||||||||||||||||||||||||||||||||||  ||||||    
T  9326758 attcttttgtgatattgttgaacttacttcgatgagattcagtttt---tctttccacagggacgacttcttgtcccgaggatttaaattgaggttgtaa 9326662  T
Q  567 gggatggaaggatggacctgtgatgtgcagc 597  Q
    ||||| |||||| ||||||||||||||||||    
T  9326661 gggatagaaggaaggacctgtgatgtgcagc 9326631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 522 - 599
Target Start/End: Original strand, 9285084 - 9285161
Alignment:
Q  522 cacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    ||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||    
T  9285084 cacagggacgacttcttgtccggaggatttaaattgagattgtaagggatggaaggaaggacctgtgatgtgcagctg 9285161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 518 - 599
Target Start/End: Complemental strand, 10346992 - 10346911
Alignment:
Q  518 ttcccacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    |||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||| |||||||||    
T  10346992 ttcccacagggatgacttcttgtcccgaggatttaaattgagattgtaagggatggtaggaaggacctgtgaagtgcagctg 10346911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 523 - 598
Target Start/End: Complemental strand, 9273344 - 9273269
Alignment:
Q  523 acagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagct 598  Q
    |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||| |||||||    
T  9273344 acagggacgacttcttgtcccgaggatttaaattgagattgtgagggatggaaggaaggacctgtgatatgcagct 9273269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 521 - 599
Target Start/End: Complemental strand, 9272002 - 9271924
Alignment:
Q  521 ccacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    |||||||| ||||||||||||||||||||||||||||| |||||||||||||||| || |||| |||||||||||||||    
T  9272002 ccacagggtcgacttcttgtcccgaggatttaaattgagattgtaagggatggaaagaaggacatgtgatgtgcagctg 9271924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 521 - 599
Target Start/End: Complemental strand, 9291253 - 9291175
Alignment:
Q  521 ccacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| | || |||||||||||||||||    
T  9291253 ccacagggaggacttcttgtcccgaggatttaaattgagattgtaagggatggaagtaagggcctgtgatgtgcagctg 9291175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 518 - 599
Target Start/End: Complemental strand, 9287887 - 9287806
Alignment:
Q  518 ttcccacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    |||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||| ||| | ||||||||||||||||||    
T  9287887 ttcccacaaggacgactttttgtcccgaggatttaaattgagattgtaagggatggatggaagtacctgtgatgtgcagctg 9287806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 518 - 599
Target Start/End: Complemental strand, 10371119 - 10371038
Alignment:
Q  518 ttcccacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    |||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||| | || ||||| |||||||||    
T  10371119 ttcccacagggacgactttttgtcccgaggatttaaattgagactgtaagggatggaaggaagaacgtgtgaagtgcagctg 10371038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 521 - 599
Target Start/End: Complemental strand, 10335014 - 10334936
Alignment:
Q  521 ccacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    ||||||||| |||||||||||||||||||||||||||| | ||||||||||||||||| | || ||||| |||||||||    
T  10335014 ccacagggatgacttcttgtcccgaggatttaaattgagactgtaagggatggaaggaagaacgtgtgaagtgcagctg 10334936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 522 - 599
Target Start/End: Original strand, 9062079 - 9062160
Alignment:
Q  522 cacagggacgacttcttgtcccgaggatttaaattgatattgtaag----ggatggaaggatggacctgtgatgtgcagctg 599  Q
    ||||||||||||||||||||||||||||||||| ||| ||||||||    ||||||||||| |||||| |||||||||||||    
T  9062079 cacagggacgacttcttgtcccgaggatttaaactgaaattgtaagggatggatggaaggaaggacctatgatgtgcagctg 9062160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 518 - 574
Target Start/End: Complemental strand, 9315364 - 9315308
Alignment:
Q  518 ttcccacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatgga 574  Q
    |||| |||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  9315364 ttccaacagggacgacttcttgtcccgaggatttaaattgagattgtaagggatgga 9315308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 532 - 589
Target Start/End: Complemental strand, 10340730 - 10340673
Alignment:
Q  532 acttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtga 589  Q
    |||| |||||||||||||||||||||| | ||||||||||||||||| ||||||||||    
T  10340730 actttttgtcccgaggatttaaattgagactgtaagggatggaaggaaggacctgtga 10340673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 521 - 578
Target Start/End: Complemental strand, 10351452 - 10351395
Alignment:
Q  521 ccacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaagga 578  Q
    |||||||||||||||||||||  ||||||||||||||| ||||||||||| |||||||    
T  10351452 ccacagggacgacttcttgtctggaggatttaaattgagattgtaagggaaggaagga 10351395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 523 - 583
Target Start/End: Original strand, 7116943 - 7117003
Alignment:
Q  523 acagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggac 583  Q
    ||||||| ||||||||||||  |||||||||||||| ||||||||||||||||||| ||||    
T  7116943 acagggaggacttcttgtccaaaggatttaaattgagattgtaagggatggaaggaaggac 7117003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 523 - 599
Target Start/End: Original strand, 12007142 - 12007218
Alignment:
Q  523 acagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    |||||||||||||| |||||||||||||||||||||  ||||||||||  |||||| | |||||| ||||| |||||    
T  12007142 acagggacgacttcctgtcccgaggatttaaattgaccttgtaagggagtgaaggaagaacctgttatgtgtagctg 12007218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 521 - 578
Target Start/End: Original strand, 9076551 - 9076608
Alignment:
Q  521 ccacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaagga 578  Q
    ||||||||| | ||||||||||  |||||||||||||| |||||||||||||||||||    
T  9076551 ccacagggatggcttcttgtccaaaggatttaaattgagattgtaagggatggaagga 9076608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 516 - 578
Target Start/End: Original strand, 9068944 - 9069006
Alignment:
Q  516 tcttcccacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaagga 578  Q
    |||| ||||||||| |  |||||||||  |||||||||||||| |||||||||||||||||||    
T  9068944 tctttccacagggatggtttcttgtccaaaggatttaaattgagattgtaagggatggaagga 9069006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 522 - 570
Target Start/End: Complemental strand, 9363767 - 9363719
Alignment:
Q  522 cacagggacgacttcttgtcccgaggatttaaattgatattgtaaggga 570  Q
    |||||||| ||||||||||||| |||||||||||||  |||||||||||    
T  9363767 cacagggatgacttcttgtcccaaggatttaaattgtcattgtaaggga 9363719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 523 - 570
Target Start/End: Original strand, 12019789 - 12019836
Alignment:
Q  523 acagggacgacttcttgtcccgaggatttaaattgatattgtaaggga 570  Q
    ||||||| ||||||||||||  |||||||||||||| |||||||||||    
T  12019789 acagggatgacttcttgtccaaaggatttaaattgacattgtaaggga 12019836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 467 - 505
Target Start/End: Original strand, 8574309 - 8574347
Alignment:
Q  467 attcttttgtgattttgttgaacttacttggatgagatt 505  Q
    ||||||||||||| ||||||||||||||| |||||||||    
T  8574309 attcttttgtgatattgttgaacttacttcgatgagatt 8574347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 523 - 599
Target Start/End: Original strand, 11988322 - 11988398
Alignment:
Q  523 acagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    ||||||| |||||||||||   |||||||||||||| |||||||||||  |||||| | |||| || |||| |||||    
T  11988322 acagggatgacttcttgtcaaaaggatttaaattgacattgtaagggagtgaaggaagaacctttgttgtgtagctg 11988398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 61; Significance: 7e-26; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 523 - 599
Target Start/End: Original strand, 41968296 - 41968372
Alignment:
Q  523 acagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    ||||||| ||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||    
T  41968296 acagggatgacttcttgtcccaaggatttaaattgagattgtaagggatggaaggaaggacctgtgatgtgcagctg 41968372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0667 (Bit Score: 51; Significance: 6e-20; HSPs: 1)
Name: scaffold0667
Description:

Target: scaffold0667; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 523 - 597
Target Start/End: Complemental strand, 1845 - 1771
Alignment:
Q  523 acagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagc 597  Q
    |||||||||||||||||||| ||||||||||||||| |||||||||| ||||| || ||| ||||||||||||||    
T  1845 acagggacgacttcttgtccggaggatttaaattgagattgtaagggttggaatgaaggatctgtgatgtgcagc 1771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 522 - 599
Target Start/End: Complemental strand, 37461687 - 37461610
Alignment:
Q  522 cacagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    ||||||||| ||||||||||| ||||||||||||||| |||||||||| |||||||| | |||||| |||||||||||    
T  37461687 cacagggaccacttcttgtccggaggatttaaattgagattgtaaggggtggaaggaagaacctgtaatgtgcagctg 37461610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 4e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 467 - 599
Target Start/End: Complemental strand, 26574297 - 26574171
Alignment:
Q  467 attcttttgtgattttgttgaacttacttggatgagatttannnnnnngtcttcccacagggacgacttcttgtcccgaggatttaaattgatattgtaa 566  Q
    ||||||||||||| || |||||||||||| ||||||||| |        | |||||||||||||||||| |||||| ||| ||||||||||| | |||||    
T  26574297 attcttttgtgatatttttgaacttactttgatgagattcatt------ttttcccacagggacgactttttgtccagagaatttaaattgagactgtaa 26574204  T
Q  567 gggatggaaggatggacctgtgatgtgcagctg 599  Q
    | |||||| ||| |||||||||| |||||||||    
T  26574203 gcgatggacggaaggacctgtgaagtgcagctg 26574171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 523 - 599
Target Start/End: Original strand, 29454250 - 29454326
Alignment:
Q  523 acagggacgacttcttgtcccgaggatttaaattgatattgtaagggatggaaggatggacctgtgatgtgcagctg 599  Q
    ||||||| |||||||||||||||||||||||||||| ||||||| |||  |||||| | | || ||||||| |||||    
T  29454250 acagggatgacttcttgtcccgaggatttaaattgaaattgtaatggagtgaaggaagaatctttgatgtgtagctg 29454326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 523 - 566
Target Start/End: Complemental strand, 29422479 - 29422436
Alignment:
Q  523 acagggacgacttcttgtcccgaggatttaaattgatattgtaa 566  Q
    ||||||| |||||||||||||||||||||||||||| |||||||    
T  29422479 acagggatgacttcttgtcccgaggatttaaattgaaattgtaa 29422436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University