View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4869_high_12 (Length: 246)
Name: NF4869_high_12
Description: NF4869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4869_high_12 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 46 - 246
Target Start/End: Complemental strand, 33757401 - 33757201
Alignment:
| Q |
46 |
gaagagtttaaaagtagttaccctccagcataacttaacatcaaaaacgattttcgaaactctaactctcccaacgccgttaaaacaccggagtcctcca |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
33757401 |
gaagagtttaaaagtagttaccctccagcataacttaacatcaaaaacgattttcgaaactctaactctcccaacgccgttaaaacaccagaatcctcca |
33757302 |
T |
 |
| Q |
146 |
acgaaggaaatgctaatggagacgtttgaaactgtgacggtaacggaaatgactgtgacggtgacggtgattgtgattgagaagaatgtttattaatcat |
245 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33757301 |
acaaaggaaatgctaacggagacgtttgaaactgtgacggtaatggaaatgactgtgactgtgacggtgattgtgattgagaagaatgtttattaatcat |
33757202 |
T |
 |
| Q |
246 |
g |
246 |
Q |
| |
|
| |
|
|
| T |
33757201 |
g |
33757201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University