View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4869_high_18 (Length: 219)
Name: NF4869_high_18
Description: NF4869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4869_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 205
Target Start/End: Original strand, 11424579 - 11424769
Alignment:
| Q |
15 |
gagatgaatgttgtacaatttggcagtggaatggtttagcagttctatttgtggttaatttaattgtttgctacaaacctgctattctgagaatattaag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11424579 |
gagatgaatgttgtacaatttggcagtggaatggtttagcagttctatttgtggttaatttaattgtttgctacaaacctgctattctgagaacattaag |
11424678 |
T |
|
| Q |
115 |
tgcatgttttggatggattgacaacaagtttgtcaatcacatgatttcaacaaaaattagactttgaagcttcaacaaaatcatggttctg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11424679 |
tgcatgttttggatggattgacaacaagtttgtcaatcacatgatttcaacaaaaattagactttgaagcttcaacaaaatcatggttctg |
11424769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 75
Target Start/End: Complemental strand, 9322563 - 9322513
Alignment:
| Q |
25 |
ttgtacaatttggcagtggaatggtttagcagttctatttgtggttaattt |
75 |
Q |
| |
|
|||||||| |||| || ||||||||||||||||||||||| ||||| |||| |
|
|
| T |
9322563 |
ttgtacaagttggtagaggaatggtttagcagttctatttttggttcattt |
9322513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 199
Target Start/End: Complemental strand, 3078965 - 3078920
Alignment:
| Q |
154 |
catgatttcaacaaaaattagactttgaagcttcaacaaaatcatg |
199 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
3078965 |
catgattttgacaaaaattacactttgaagcttcaacagaatcatg |
3078920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University