View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4869_low_15 (Length: 237)
Name: NF4869_low_15
Description: NF4869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4869_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 47 - 164
Target Start/End: Original strand, 13807541 - 13807658
Alignment:
| Q |
47 |
atgtatactagcgatcaaaattgaataaaatttatgtgggaattaaaactgaataatatagaaagaaattaaacttgggttttagaaaatggtaaaattc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13807541 |
atgtatactagcgatcaaaattgaataaaatttatgtgggaattaaaactgaataatatagatagaaattaaacttgggttttagaaaatggtaaaattc |
13807640 |
T |
|
| Q |
147 |
tatattagattgaagctc |
164 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
13807641 |
tacattagattgaagctc |
13807658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 13807414 - 13807461
Alignment:
| Q |
1 |
ttttaaactacccacaaaatcacgatctttcaagtttaccctctacat |
48 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13807414 |
ttttaaagtacccacaaaatcacgatctttcaagtttaccctctacat |
13807461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University