View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4869_low_20 (Length: 210)
Name: NF4869_low_20
Description: NF4869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4869_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 12 - 195
Target Start/End: Complemental strand, 43392675 - 43392492
Alignment:
| Q |
12 |
gataattctaacaggtaacttatgctgctgaatagctcacattttttctctttaattatgttatttcaacttaatttcatagaataactactaacaaata |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43392675 |
gataactctaacaggtaacttatgctgctgaatagctcacattttttctctttaattatgttatttcaacttaatttcatagaataaccactaacaaata |
43392576 |
T |
|
| Q |
112 |
agatnnnnnnnntttccttcttttttaacataaaactaatgatttttattgataaaacgacaactagtacaaatggtattaaat |
195 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43392575 |
agataaaaaaaatttccttcttttttaacataaaactaatgatttttattgataaaacgacaactagtacaaatggtattaaat |
43392492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 113
Target Start/End: Original strand, 30311430 - 30311497
Alignment:
| Q |
48 |
tcacattttttctctttaattatgttatttcaactt--aatttcatagaataactactaacaaataag |
113 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
30311430 |
tcacatttttcatctttaattatgttatctcaacttaaaattttagaaaataactactaacaaataag |
30311497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University