View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4870-Insertion-10 (Length: 317)
Name: NF4870-Insertion-10
Description: NF4870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4870-Insertion-10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 1e-41; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 136 - 246
Target Start/End: Complemental strand, 19974300 - 19974190
Alignment:
| Q |
136 |
accttatgccttttccttttaaaagaaagaaagaaaagtcccttatttacaaactgtttagaaacaaaaataggaattgctacttcgggaactatcatag |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
19974300 |
accttatgccttttccttttaaaagaaagaaagaaaagtcccttatttacacactttttagaaacaaaaataggaattgccactttgggaactatcatag |
19974201 |
T |
|
| Q |
236 |
attgctactat |
246 |
Q |
| |
|
| |||||||| |
|
|
| T |
19974200 |
ctagctactat |
19974190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 19974468 - 19974357
Alignment:
| Q |
8 |
catgcatctaatactgccgataatcaagctaagctcaaggatttttcaagtcatcataatgatgcaaccttgtatgtttcgtgtgct-----tttgtcta |
102 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
19974468 |
catgcatctaatactgccgataatcaggctaagctcaaggatttttcaagtcatcataatgatgtaaccttgtatgtatcgtgtgctcacagtttgtcta |
19974369 |
T |
|
| Q |
103 |
tttaattcccct |
114 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19974368 |
tttaattcccct |
19974357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 271 - 317
Target Start/End: Complemental strand, 19973996 - 19973950
Alignment:
| Q |
271 |
tcatctagttctgaatttcagttgctttggtgattttaatttcttga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19973996 |
tcatctagttctgaatttcagttgctttggtgattttagtttcttga |
19973950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University