View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4870-Insertion-12 (Length: 173)
Name: NF4870-Insertion-12
Description: NF4870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4870-Insertion-12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 1e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 6 - 107
Target Start/End: Complemental strand, 9262191 - 9262090
Alignment:
| Q |
6 |
caaaaccatccttgttcgttcaacatagatctgaagcggctcgaaaaatgcaatagaacgtgttcgtttgtgtgggaggcgatggaggagtggatgatga |
105 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9262191 |
caaaaccatccttgtttgttcaacatagatctgaagcggctcgaaaaatgcaatagaacgtgttcgtttgtgtgggaggcgatggaggagtggatgatga |
9262092 |
T |
|
| Q |
106 |
tg |
107 |
Q |
| |
|
|| |
|
|
| T |
9262091 |
tg |
9262090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.0000000009
Query Start/End: Original strand, 140 - 172
Target Start/End: Complemental strand, 9262092 - 9262060
Alignment:
| Q |
140 |
atgggagaaggagaatgagtgttgttgtgttgc |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9262092 |
atgggagaaggagaatgagtgttgttgtgttgc |
9262060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 5e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 5e-30
Query Start/End: Original strand, 9 - 173
Target Start/End: Complemental strand, 29000561 - 29000396
Alignment:
| Q |
9 |
aaccatccttgttcgttcaacatagatctgaagcggctcgaaaaatgcaatagaacgtgttcgtttgtgtgggaggcgatggaggag-tggatgatgatg |
107 |
Q |
| |
|
||||| ||| ||| ||||| ||||||||||||| | ||||||| |||||| ||||||||||||||||||||||||| | ||||| |||| |||| || |
|
|
| T |
29000561 |
aaccaacctcgtttgttcaccatagatctgaagtgaatcgaaaattgcaattgaacgtgttcgtttgtgtgggaggcagta-aggaggtggacgatggtg |
29000463 |
T |
|
| Q |
108 |
attcaattag-gggtggttctgtcatggtgaaaatgggagaaggagaatgagtgttgttgtgttgca |
173 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29000462 |
gttcaattgctggggggttctgtcatggtgaaaatgagagaaggagaatgagtgttgttgtgttgca |
29000396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 122 - 173
Target Start/End: Original strand, 44663833 - 44663884
Alignment:
| Q |
122 |
ggttctgtcatggtgaaaatgggagaaggagaatgagtgttgttgtgttgca |
173 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
44663833 |
ggttctgtcatggtgaaaatgagacaaggagaatgagtgttgttgtgttgca |
44663884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 44656401 - 44656477
Alignment:
| Q |
9 |
aaccatccttgttcgttcaacatagatctgaagcggctcgaaaaatgcaatagaacgtgttcgtttgtgtgggaggc |
85 |
Q |
| |
|
||||| ||| ||| ||||| ||||||||||||| | ||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
44656401 |
aaccaacctcgtttgttcaccatagatctgaagtgaatcgaaaattgcaattgaacgtgttcgtttgtgtgggaggc |
44656477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 75 - 163
Target Start/End: Complemental strand, 5687708 - 5687620
Alignment:
| Q |
75 |
gtgtgggaggcgatggaggagtggatgatgatgattcaattaggggtggttctgtcatggtgaaaatgggagaaggagaatgagtgttg |
163 |
Q |
| |
|
||||||||||| |||||||||| | | |||||||| | || | ||||||| | |||||||||||||| | |||||||| | ||||||| |
|
|
| T |
5687708 |
gtgtgggaggcagtggaggagtgaacggtgatgatttagttggtggtggttgtttcatggtgaaaatgagggaaggagagttagtgttg |
5687620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 75 - 163
Target Start/End: Original strand, 31624964 - 31625052
Alignment:
| Q |
75 |
gtgtgggaggcgatggaggagtggatgatgatgattcaattaggggtggttctgtcatggtgaaaatgggagaaggagaatgagtgttg |
163 |
Q |
| |
|
|||||||||||| |||||||||| | | |||| ||| | || | ||||||| | |||||||||||||| | |||||||| | ||||||| |
|
|
| T |
31624964 |
gtgtgggaggcggtggaggagtgaacggtgattatttagttggtggtggttgtttcatggtgaaaatgagggaaggagagttagtgttg |
31625052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University