View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4870-Insertion-13 (Length: 389)
Name: NF4870-Insertion-13
Description: NF4870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4870-Insertion-13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 211
Target Start/End: Original strand, 2343992 - 2344190
Alignment:
| Q |
13 |
aataaagaacctttatatcctttctcaagttgtaaaagagttataacttaaaatgcttgtacgcttccaagaagagatacagtggtttggtttcaaactt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2343992 |
aataaagaacctttatatcctttctcaagttgtaaaagagttataacttaaattgcttgtacgcttccaagaagagatacagtggtttggtttcaaactt |
2344091 |
T |
|
| Q |
113 |
cacttattatgattctatttaagtatcagtgaaaatggtttcacaaaatatattgaatttagttaatgattatgaacctaattagttcctttgatgcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2344092 |
cacttattatgattctatttaagtattagtgaaaatggtttcacaaaatatattgaatttagttaatgattatgaaactaattagttcctttgatgcaa |
2344190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University