View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4870-Insertion-15 (Length: 134)
Name: NF4870-Insertion-15
Description: NF4870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4870-Insertion-15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 4e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 4e-42
Query Start/End: Original strand, 7 - 134
Target Start/End: Original strand, 25783740 - 25783867
Alignment:
| Q |
7 |
attacggtccccataaacagatcctttccaattttccggtagaaggtcttcataataatcatcatcagaagcacagtacgcataagaataatctggaagt |
106 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||| |
|
|
| T |
25783740 |
attatggtccccataaacagatccattccaattttccggtagaaggtcttcataataatcatcatcagaagcacagaacgcat---aaaaatctggaagt |
25783836 |
T |
|
| Q |
107 |
ctaaaa---tctttgattctttcatggcaca |
134 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
25783837 |
ctaaaatattctttgattctttcatggcaca |
25783867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University