View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4870_high_4 (Length: 370)
Name: NF4870_high_4
Description: NF4870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4870_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 7e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 21 - 181
Target Start/End: Complemental strand, 25783743 - 25783584
Alignment:
| Q |
21 |
taatttgtccatgatgttaaaacatgactgaaaattccgacggtgatccttgaaaattatgatgtgttctttcttttttcaatgttacttgtattccccc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25783743 |
taatttgtccatgatgttaaaacatgactgaaaattccgacggtgatccttgaaaattatgatgtgttctttcttttttcaatgttacttgtattccccc |
25783644 |
T |
|
| Q |
121 |
tcccctaaaatggtttactcttatgttgttggcatatgatttattaatgtaatagattatc |
181 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25783643 |
tcccct-aaatgttttactcatatgttgttggcatatgctttattaatgtaatagattatc |
25783584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University