View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4870_low_11 (Length: 228)
Name: NF4870_low_11
Description: NF4870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4870_low_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 34 - 228
Target Start/End: Complemental strand, 6451190 - 6450993
Alignment:
| Q |
34 |
aaataatgttgtgtttaaaatttgataaaatcacttttgacattgcatttat----gttgaattttaatttttaaacacggaatttttctacatgtttta |
129 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6451190 |
aaataatgttgtgcttaaaatttgataaaatcacttt-gacattgcatttatatatgttaaattttaatttttaaacacggaatttttctacatatttta |
6451092 |
T |
 |
| Q |
130 |
tcaaacggtcactcatctctcacatgctctaaatgaaggatgtttaaatatgaagctctcatgttttgtactaccgaaaaaagatatgtcttgttggta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6451091 |
tcaaacggtcactcatctctcacatgctttaaatcaaggatgtttaaatatgaagctctgatgttttgtactacagaaaaaagatatgtcttgttggta |
6450993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University