View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4870_low_9 (Length: 263)

Name: NF4870_low_9
Description: NF4870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4870_low_9
NF4870_low_9
[»] chr8 (2 HSPs)
chr8 (1-188)||(39072845-39073033)
chr8 (215-247)||(39072786-39072818)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 39073033 - 39072845
Alignment:
1 tttattgatttaatactgtaattaactaaaattctaccnnnnnnnnnnnctttaattagctaaaagagaagagggaataaacaataaaa-ggggttaatt 99  Q
    ||||||||||||||||| |||||| |||||||||||||           |||||||||||||||||| ||||||||||||||||||||| ||||||||||    
39073033 tttattgatttaatactttaattagctaaaattctaccaaaaaaaaaa-ctttaattagctaaaagataagagggaataaacaataaaaaggggttaatt 39072935  T
100 tgagatatttgatcaacnnnnnnn-gaacaacagaagaaatgaatattcaataaaacgagtataaaggatactcaaactcaaaagacgat 188  Q
    |||||||||||||||||        |||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||    
39072934 tgagatatttgatcaacttttttttgaacaacagaagaaatgaatattcaataaaacgaatataaatgatactcaaactcaaaagacgat 39072845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 215 - 247
Target Start/End: Complemental strand, 39072818 - 39072786
Alignment:
215 atttttggatatgatcatttgaaatgaaacaac 247  Q
    |||||||||||||||||| ||||||||||||||    
39072818 atttttggatatgatcatatgaaatgaaacaac 39072786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University