View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4871-Insertion-8 (Length: 312)
Name: NF4871-Insertion-8
Description: NF4871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4871-Insertion-8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 234
Target Start/End: Original strand, 35482222 - 35482449
Alignment:
| Q |
7 |
aatctcttcatcagtgttggcctgtacaagagtgtcacgaacttgagttgcgactatgatacgattctgttcgacaccggtgatgccggtggtttcttca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35482222 |
aatctcttcatcagtgttggcctgtacaagagtgtcacgaacttgagttgcgactatgatacgattctgttcgacaccggtgatgccggtggtttcttca |
35482321 |
T |
|
| Q |
107 |
agggtgggaggtgaaaagccttcacggaggagggaagtgatgagaggagcgtattcgtgccaggcaccgagacggttggcgaggatgtcaatgcgacctg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35482322 |
agggtgggaggtgaaaagccttcacggaggagggaagtgatgagaggagcgtattcgtgccaggcaccgagacggttggcgaggatgtcgatgcgacctg |
35482421 |
T |
|
| Q |
207 |
ggatgtcgaggttgtcgtattttgatgg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
35482422 |
ggatgtcgaggttgtcgtattttgatgg |
35482449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University