View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4871_high_9 (Length: 213)
Name: NF4871_high_9
Description: NF4871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4871_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 9 - 170
Target Start/End: Complemental strand, 12003914 - 12003753
Alignment:
| Q |
9 |
agcagagacgggtttggttgaatattctcgatttctagatctcttcagaaaccaagagtcactaatagtcaatttcactggtctcttgctctttttgttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12003914 |
agcagagacgggtttggttgaatattctcgatttttagatctcttcagaaaccaagagtcactaatagtcaatttcactggtctcttgctgtttttgttt |
12003815 |
T |
|
| Q |
109 |
gctgtatttgttagcctctctgtcattcttccaagaaattactgattaaattaatttacgta |
170 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12003814 |
gctgtctttgttagcctctctgtcattcttccaagaaattactgattaaattaatttacgta |
12003753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University