View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4871_low_10 (Length: 221)
Name: NF4871_low_10
Description: NF4871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4871_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 2 - 105
Target Start/End: Complemental strand, 12003710 - 12003607
Alignment:
| Q |
2 |
acatcaaaattttgatgtcaaatataatattttaaattttgtatttctttaaaatgtttgtaagtggtagacaataaaaaataaagaggagatatccata |
101 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
12003710 |
acatcaaaattttaatgtcaaatataatattttaaattttgtatttctttaaaatgtttgtaagtggtagatgataaaaaataaagaggagatattgata |
12003611 |
T |
 |
| Q |
102 |
tgta |
105 |
Q |
| |
|
|||| |
|
|
| T |
12003610 |
tgta |
12003607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University