View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4871_low_5 (Length: 278)
Name: NF4871_low_5
Description: NF4871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4871_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 95 - 274
Target Start/End: Complemental strand, 2630586 - 2630407
Alignment:
| Q |
95 |
ttaatctgaattagtcatgtcaccgagtgatttttgactttccgaaggtagattatgtcatatgctggagttgcaatctcaatctactattttacaccgg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2630586 |
ttaatctgaattagtcatgtcaccgagtgatttttgactttccgaaggtagattatgtcatatgctggagttgcaatctcaatctactcttttacaccgg |
2630487 |
T |
 |
| Q |
195 |
tggttaactttgtttttgtaatcatctatctattcttttgaaatacagccttagtggtatgggttcacaaattatgttat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2630486 |
tggttaactttgtttttgtaatcatctatctattcttttgaaatacagccttagtggtatcggttcacaaattatgttat |
2630407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 2630759 - 2630689
Alignment:
| Q |
1 |
tagaaccgtatgaaacataagaaaaatttacccaacaccttaacagttatatttttagccctacaaaccat |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2630759 |
tagaaccgtatgaaacataagaaaaatttacccaacaccttaacagttatatttttagccctacaaaccat |
2630689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University