View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4874-Insertion-7 (Length: 214)
Name: NF4874-Insertion-7
Description: NF4874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4874-Insertion-7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 7 - 70
Target Start/End: Complemental strand, 40464162 - 40464099
Alignment:
| Q |
7 |
aatattattggtcatatatgtgttggtaaattttgatggtctattatagactaaaaatataacc |
70 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40464162 |
aatattattggtcatatatgttttggtaaattttgatggtctattatagactaaaaatataacc |
40464099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University