View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4874-Insertion-8 (Length: 73)

Name: NF4874-Insertion-8
Description: NF4874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4874-Insertion-8
NF4874-Insertion-8
[»] chr8 (3 HSPs)
chr8 (7-73)||(7416640-7416706)
chr8 (11-73)||(7431615-7431677)
chr8 (7-73)||(7425626-7425692)


Alignment Details
Target: chr8 (Bit Score: 67; Significance: 2e-30; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 7 - 73
Target Start/End: Complemental strand, 7416706 - 7416640
Alignment:
7 aagaagatgttggatgagttgtttttacttaatggaattctcaatattggggattttattccttgga 73  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7416706 aagaagatgttggatgagttgtttttacttaatggaattctcaatattggggattttattccttgga 7416640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 11 - 73
Target Start/End: Complemental strand, 7431677 - 7431615
Alignment:
11 agatgttggatgagttgtttttacttaatggaattctcaatattggggattttattccttgga 73  Q
    |||||||||||||||||||||| ||||||||  |  |||||||||||||||||||||||||||    
7431677 agatgttggatgagttgtttttgcttaatggggtcttcaatattggggattttattccttgga 7431615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.00000000000009
Query Start/End: Original strand, 7 - 73
Target Start/End: Complemental strand, 7425692 - 7425626
Alignment:
7 aagaagatgttggatgagttgtttttacttaatggaattctcaatattggggattttattccttgga 73  Q
    ||||||||||| ||||| |||||||| ||||||||  | |||||| |||||||||||||||||||||    
7425692 aagaagatgttagatgaattgtttttgcttaatggggtcctcaatgttggggattttattccttgga 7425626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University