View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4874-Insertion-8 (Length: 73)
Name: NF4874-Insertion-8
Description: NF4874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4874-Insertion-8 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 2e-30; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 7 - 73
Target Start/End: Complemental strand, 7416706 - 7416640
Alignment:
| Q |
7 |
aagaagatgttggatgagttgtttttacttaatggaattctcaatattggggattttattccttgga |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416706 |
aagaagatgttggatgagttgtttttacttaatggaattctcaatattggggattttattccttgga |
7416640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 11 - 73
Target Start/End: Complemental strand, 7431677 - 7431615
Alignment:
| Q |
11 |
agatgttggatgagttgtttttacttaatggaattctcaatattggggattttattccttgga |
73 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
7431677 |
agatgttggatgagttgtttttgcttaatggggtcttcaatattggggattttattccttgga |
7431615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.00000000000009
Query Start/End: Original strand, 7 - 73
Target Start/End: Complemental strand, 7425692 - 7425626
Alignment:
| Q |
7 |
aagaagatgttggatgagttgtttttacttaatggaattctcaatattggggattttattccttgga |
73 |
Q |
| |
|
||||||||||| ||||| |||||||| |||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
7425692 |
aagaagatgttagatgaattgtttttgcttaatggggtcctcaatgttggggattttattccttgga |
7425626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University