View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4874_high_2 (Length: 330)
Name: NF4874_high_2
Description: NF4874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4874_high_2 |
 |  |
|
| [»] scaffold1252 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1252 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: scaffold1252
Description:
Target: scaffold1252; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 186 - 320
Target Start/End: Original strand, 1974 - 2108
Alignment:
| Q |
186 |
actgtttgatttgcatgaaatagaattaccatagaattgaattggagttgagtaatgacttggttcttgtatagagtaatcaatagtttactgtgtgatt |
285 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1974 |
actgtttgatttgcatgaaataggattaccatagaattgaattggagttgagtaatgacttggttcttgtatagagtaatcaatagtttactgtgtgatt |
2073 |
T |
 |
| Q |
286 |
tttctacatgagaaaaatgggaatttcatcctttg |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2074 |
tttctacatgagaaaaatgggaatttcatcctttg |
2108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1252; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 1809 - 1908
Alignment:
| Q |
18 |
agaaatttgttgaatttaatcatgggctgttttgattttatgaatttggatagaaatttagtttttaagggattaagattaatcaatagcttgttgtgtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1809 |
agaaatttgttgaatttaatcatgggctgttttgattttatgaatttggatagaaatttagtttttaagggataaagattaatcaatagcttgttgtgtg |
1908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 181 - 324
Target Start/End: Complemental strand, 20883467 - 20883325
Alignment:
| Q |
181 |
cattaactgtttgatttgcatgaaatagaattaccatagaattgaattggagttgagtaatgacttggttc-ttgtatagagtaatcaatagtttactgt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||| | | |
|
|
| T |
20883467 |
cattaactgtttgatttgcatgaaataggattaccatagaattgaattggagttgtgtagtgacttggttctttgtatagagtaatcaatagttta-ttt |
20883369 |
T |
 |
| Q |
280 |
gtgatttttctacatgagaaaaatgggaatttcatcctttgcttc |
324 |
Q |
| |
|
||||||||| ||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
20883368 |
gtgatttttgtacttgaggaaaat-ggaatttcatcctttgcttc |
20883325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 20883624 - 20883524
Alignment:
| Q |
18 |
agaaatttgttgaatttaatcatgggctgttttgattttatgaatttggatagaaatttagtttttaagggattaagattaatcaatagcttgttgtgtg |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20883624 |
agaaatttgctgaatttaatcatgggctgttttgattttatgaatttggatagaactttagttattaagggattaagattaatcaatagcttgttgtgtg |
20883525 |
T |
 |
| Q |
118 |
a |
118 |
Q |
| |
|
| |
|
|
| T |
20883524 |
a |
20883524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University